Sanger Sequencing

ABI 3730
Dye-terminator sequencing is performed using a modified protocol supplied by Applied Biosystems BigDye Terminator 1.1 and 3.1 Cycle sequencing kits.  All reactions are analyzed using the 3730 Genetic Analyzer.  Sequencing can be performed on a variety of templates including PCR product, plasmids, and BACs.

 

Sample Submission 

Samples are processed on Monday and Thursday mornings only (We no longer process samples on a daily basis).  Data will be ready the following morning.  Samples and primers must be submitted in separate tubes. Please make sure to clearly label each tube with the appropriate name, the date, and your name or initials.  Large sets of sequencing can be submitted in a 96-well plate format with a volume of 10ul per reaction. There is a price reduction for processing more than 96 reactions at a time.  For just $1 per sample, the Core provides an Exo-SAP treatment service to PCR products if no other clean-up step has been preformed.  Please provide at least 10ul of PCR product if you would like this service.  Finally, fill out the Sequencing Request form and bring your samples to the Core on the 7th floor of the BRB.

 

Type of Template: Quantity:
Plasmid 100-300ng per reaction
Short PCR product (<500bp) 50-100ng per reaction
Long PCR product (>500bp) 100-200ng per reaction
Primer 2ul of 20uM concentration per reaction

 

Primers


All primers must be submitted in separate tubes at a 20uM concentration, clearly labeled with the date and your name or initials.  Please provide at least 2ul of primer per reaction and list an annealing temperature on the request form.  The Genomics Core does offer universal primers at no cost to the user.

 

Universal primers stocked by the Core

BGH reverse: 5’ TAGAAGGCACAGTCGAGG
CMV-for 5’ CGCAAATGGGCGGTAGGCGTG
GLprimer1 5’ TGTATCTTATGGTACTGTAACTG
GLprimer2 5’ CTTTATGTTTTTGGCGTCTTCC
M13 Forward: 5’ GTTTTCCCAGTCACGAC
M13 Reverse 5’ AACAGCTATGACCATG
pGEX 3′ CCGGGAGCTGCATGTGTCAGAGG
pGEX 5′ GGGCTGGCAAGCCACGTTTGGTG
SP6 5’ ATTTAGGTGACACTATA
T3 5’ AATTACCCTCACTAAAGGG
T7 promoter 5’ TAATACGACTCACTATAGGG
T7 terminator GCTAGTTATTGCTCAGCGGT

 


Results


Data can be accessed through the Helix fileserver which is accessible to all systems on the Case network.  An account for your lab can be created where data files can be securely stored and retrieved.  Please email the Genetics Department Computer Systems Administrator, Ulrich Neuss (Uli) at helix@case.edu to set up an account.  In the e-mail please specify your name, e-mail address, your principal investigator, and explain that you would like access to the facility to get your data.

Leave a Reply

  • Announcements

  • NGS Tags