Sanger Sequencing

ABI 3730

Dye-terminator sequencing is performed using a modified protocol supplied by Applied Biosystems BigDye Terminator 1.1 and 3.1 Cycle sequencing kits. All reactions are analyzed using a 48-cappilary 3730 Genetic Analyzer. Sanger Sequencing can be performed on a variety of templates including PCR product, plasmids, and BACs for analysis of mutation detection and traditional DNA sequencing.

The Genomics Core offers quality sequencing data, with a fast turn-around time, and knowledgeable help with troubleshooting. Discounts are available for large projects.

 

 

 

 

Sample Submission 

  • Fill out the Sequencing Request form and bring your samples to the Core on the 7th floor of the BRB.
  • Samples are processed on Monday and Thursday mornings (9am) and data will be released the next day.
  • Samples and primers must be submitted in separate tubes. NO STRIP TUBES.
  • Clearly label each tube with the appropriate name, the date, and your name / initials.
  • Large sets of samples can be submitted in a 96-well plate format with a volume of 10ul per reaction. (There is a price reduction for processing more than 96 reactions at a time.)
  • EXO-SAP service to clean-up PCR products is available @ $1 per reaction. Provide 10ul of PCR product.

 

Type of Template Quantity Required
Plasmid 100-300ng per reaction
Short PCR product (<500bp) 50-100ng per reaction
Long PCR product (>500bp) 100-200ng per reaction
Primer 2ul of 20uM concentration per reaction

 

 

Primers

 

  • All primers must be submitted in separate tubes at a 20uM concentration
  • Clearly label each primer with the appropriate name, the date and your name / initials.
  • Provide at least 2ul of primer per reaction and list an annealing temperature on the request form.
  • The Genomics Core does offer universal primers at no cost to the user.

 

Universal primers stocked by the Core

NAME SEQUENCE
BGH reverse 5’ TAGAAGGCACAGTCGAGG
CMV-for 5’ CGCAAATGGGCGGTAGGCGTG
GLprimer1 5’ TGTATCTTATGGTACTGTAACTG
GLprimer2 5’ CTTTATGTTTTTGGCGTCTTCC
M13 Forward 5’ GTTTTCCCAGTCACGAC
M13 Reverse 5’ AACAGCTATGACCATG
pGEX 3′ CCGGGAGCTGCATGTGTCAGAGG
pGEX 5′ GGGCTGGCAAGCCACGTTTGGTG
SP6 5’ ATTTAGGTGACACTATA
T3 5’ AATTACCCTCACTAAAGGG
T7 promoter 5’ TAATACGACTCACTATAGGG
T7 terminator GCTAGTTATTGCTCAGCGGT

 

 

Results

Data can be accessed through the Helix fileserver which is accessible to all systems on the Case network. An account for your lab can be created where data files can be securely stored and retrieved. Please email the Genetics Department Computer Systems Administrator, Ulrich Neuss (Uli) at helix@case.edu to set up an account. In the e-mail please specify your name, e-mail address, your principal investigator, and explain that you would like access to the facility to get your data.

Leave a Reply